Exam
Dear all, if you wish to see the correct answer for last Friday's test... (more…)
A small tale from a BLAST
Dear students, we performed a simple "de novo assembly" using the gDNA reads longer than 100bp. This gave us 5Mbs of assembly spread across 27222 contigs (N50=190). We BLASTed one of the largest contigs (~2kb) against "nr" and found: (more…)
Day4: Self serve lab
Today you're going to take a "self serve" lab. Skim this post and decide where to focus (no particular order suggested/required). We recommend to review thing you found difficult/no clear. For technical aspects feel always free to ask us. We suggest to dedicate at least some time, if not the whole afternoon, to riboclass data analysis. If you need to write notes, create a day4.txt in the dir-01 directory :) (more…)
Updates to timetable!
Please remember that on Friday we'll meet in Aula D (Pr) @ Vallisneri (h. 14.00). Bring your laptop if you have it, possibly fully charged. Have a look at the Calendar, as we have the date for the exam too! (more…)
Day3.2: A look at our alignments
Submit a job to CAMERA You'll find in your home folder a new directory called "files". Inside it we put a random selection of reads from both RNA-Seq and WGS (called like rrna.geno-XX.fasta and gdna.geno-XX.fasta). Submit both to CAMERA using a proper analysis. A look at our outputs We launched a BLAST alignment of short reads against a 16S ribosomal database (using -m 8 for tabular output), and we did the same using PASS (asking for SAM output). You will find both outputs in the "files" directory, in your home. Today we'll play with pass_output.sam from PASS. (more…)
Day3.1: Let’s do a cooperative job
Today we will meet CAMERA PORTAL! Enter the web site and request an account. The e-mail reply should be fairly quick. First of all, take some time to look at the resources available. This portal was conceived for metagenomic analysis and allows you to submit your data to a central server where they will be elaborated according to your instructions. (more…)
Day2: mastering (command line) alignments
Welcome to the second day of our bioinformatics practicals. Start as usual with the "appello Name Surname" command so that we do our automatic head count. As a small update this morning the Proton run of our (meta)genomic sample finished giving us 5Gbp of data! Which resources? Your goal here is to be creative and think the (endless) possibilities you have to analyse the Ion Proton sequences. Referring to the small preview of the sequencing results use any online tool you wish (take some time to Google for rRNA classification, metagenomics data analysis and so and forth) to annotate those sequences. Critical thinking is important, as there is no "right tool" but a correct use of tools. As we said yesterday, BLAST is powerful and certainly would fit... as long as we…
Gift!
Enjoy this! >ZG60V:01233:12955 ACTGGTTGTTGGGTCTTCACTGACTCAGTAACGAAGCTAACGCGTGAAGTTGACCGCCTGGGGAGTACGG CCGCAAGGTTGAAACTCAAAGGAATTGACGGGGACCCGCAGAAGCGGTGGACTGATGTGGTTAATTCGAT GCAACG >ZG60V:01233:06198 TGGGTGAAGTGAAACAATCTCAGTACCAGAGGAGGAGAAATCAAACAGGAGATTCCGTCAGTAGCGGCGA GCGAAAAGCGGATTAGGACAAACCCAATGGCTTGACATTGGGGGTTGTAGGACCATAAACGTGAGACTAA AGAAGATAGATGAAATACTTGGAAAAGTGTAGCATAGAAGGTGAAACTC >ZG60V:02846:01233 GGAGAAGGTATGCCCTAAGTAGGTGAAGTTGTACAAACGGAGCTGAACAGGGTTGCAAAAAAAATCGGGT GGCTGCGACTGTTTAATAAAAAACACAGCACTCTGCAAACACGAAAGTGGACGTATAGGGTGTGACGCCT GCCCGG >ZG60V:01233:08052 AGAGACGCCAGTTTCTGTGGAGCCGCCCTTGAAATACCACCCTGGTGTGTTTGAGGTTCTACCTTGGTCC GTCATCCGGATCGGGGACCGTGCATGGTAGGCAGTTTGACTGGGGCGGTCTCCTCCCAAAGTGTAACGGT GGAGCCAACTTCGAAAGAAGGCATTGCGTGGTGGGTAGTTTGACT
Command line BLAST!
Time has come to perform a BLAST from the command line, finally. This enable you using thousand if not billions of sequences as query, and to use a custom database as a reference. Your goals are to set up a local BLAST and test it, and to prepare the command to BLAST all the metagenomics sequences produced by the Ion Proton against the proper database. (more…)
Unleashing the power of the shell
The first part of today's lab introduced you to Linux, files and the shell. Now we want to see why Linux is so popular (~90% market share) among bioinformatics developers and users. There are several reasons, and now we'll see how flexible it is the shell to be used to produce analytical pipelines. (more…)