Day4: Self serve lab

Today you’re going to take a “self serve” lab. Skim this post and decide where to focus (no particular order suggested/required). We recommend to review thing you found difficult/no clear. For technical aspects feel always free to ask us. We suggest to dedicate at least some time, if not the whole afternoon, to riboclass data analysis.

If you need to write notes, create a day4.txt in the dir-01 directory :)

Continue reading

Day3.2: A look at our alignments

Submit a job to CAMERA

You’ll find in your home folder a new directory called “files“. Inside it we put a random selection of reads from both RNA-Seq and WGS (called like rrna.geno-XX.fasta and gdna.geno-XX.fasta).
Submit both to CAMERA using a proper analysis.

A look at our outputs

We launched a BLAST alignment of short reads against a 16S ribosomal database (using -m 8 for tabular output), and we did the same using PASS (asking for SAM output).

You will find both outputs in the “files” directory, in your home. Today we’ll play with pass_output.sam from PASS.

Continue reading

Day2: mastering (command line) alignments

Welcome to the second day of our bioinformatics practicals. Start as usual with the “appello Name Surname” command so that we do our automatic head count.
As a small update this morning the Proton run of our (meta)genomic sample finished giving us 5Gbp of data!

Which resources?

Your goal here is to be creative and think the (endless) possibilities you have to analyse the Ion Proton sequences.

Referring to the small preview of the sequencing results use any online tool you wish (take some time to Google for rRNA classification, metagenomics data analysis and so and forth) to annotate those sequences. Critical thinking is important, as there is no “right tool” but a correct use of tools. As we said yesterday, BLAST is powerful and certainly would fit… as long as we remember its limitations.
Create a “preview.txt” file in the “dir-01” directory annotating:
Continue reading

Gift!

Enjoy this!

>ZG60V:01233:12955
ACTGGTTGTTGGGTCTTCACTGACTCAGTAACGAAGCTAACGCGTGAAGTTGACCGCCTGGGGAGTACGG
CCGCAAGGTTGAAACTCAAAGGAATTGACGGGGACCCGCAGAAGCGGTGGACTGATGTGGTTAATTCGAT
GCAACG
>ZG60V:01233:06198
TGGGTGAAGTGAAACAATCTCAGTACCAGAGGAGGAGAAATCAAACAGGAGATTCCGTCAGTAGCGGCGA
GCGAAAAGCGGATTAGGACAAACCCAATGGCTTGACATTGGGGGTTGTAGGACCATAAACGTGAGACTAA
AGAAGATAGATGAAATACTTGGAAAAGTGTAGCATAGAAGGTGAAACTC
>ZG60V:02846:01233
GGAGAAGGTATGCCCTAAGTAGGTGAAGTTGTACAAACGGAGCTGAACAGGGTTGCAAAAAAAATCGGGT
GGCTGCGACTGTTTAATAAAAAACACAGCACTCTGCAAACACGAAAGTGGACGTATAGGGTGTGACGCCT
GCCCGG
>ZG60V:01233:08052
AGAGACGCCAGTTTCTGTGGAGCCGCCCTTGAAATACCACCCTGGTGTGTTTGAGGTTCTACCTTGGTCC
GTCATCCGGATCGGGGACCGTGCATGGTAGGCAGTTTGACTGGGGCGGTCTCCTCCCAAAGTGTAACGGT
GGAGCCAACTTCGAAAGAAGGCATTGCGTGGTGGGTAGTTTGACT

Command line BLAST!

Time has come to perform a BLAST from the command line, finally. This enable you using thousand if not billions of sequences as query, and to use a custom database as a reference.
Your goals are to set up a local BLAST and test it, and to prepare the command to BLAST all the metagenomics sequences produced by the Ion Proton against the proper database.

Continue reading